Do Any Animals Have Rh Negative Blood

Abstract

By amplification and sequencing of RH gene intron 4 of various primates we demonstrate that an Alu-Sx-like element has been inserted in the RH gene of the common ancestor of humans, apes, Old World monkeys, and New Globe monkeys. The study of mouse and lemur intron four sequences allowed us to precisely define the insertion point of the Alu-Sx chemical element in intron 4 of the RH gene antecedent common to Anthropoidea. Similar humans, chimpanzees and gorillas possess two types of RH intron 4, characterized by the presence (human RHCE and ape RHCE-like genes) or absenteeism (human RHD and ape RHD-like genes) of the Alu-Sx element. This led us to conclude that in the RH common ancestor of humans, chimpanzees, and gorillas, a duplication of the mutual ancestor gene gave rise to two genes, one differing from the other past a 654-bp deletion encompassing an Alu-Sx element. Moreover, near of chimpanzees and some gorillas possess two types of RHD-like intron 4. The introns 4 of type 1 accept a length similar to that of human RHD intron 4, whereas introns 4 of type 2 display an insertion of 12 bp. The latest insertion was not found in the homo genome (72 individuals tested). The study of RH intron 3 length polymorphism confirmed that, like humans, chimpanzees and gorillas possess two types of intron 3, with the RHD-type intron iii being 289 bases shorter than the RHCE intron 3. Past amplification and sequencing of regions encompassing introns 3 and 4, nosotros demonstrated that chimpanzee and gorilla RH-similar genes displayed associations of introns iii and iv distinct to those institute in man. Birthday, the results demonstrate that, equally in humans, chimpanzee and gorilla RH genes experienced intergenic exchanges.

Introduction

The human RH blood group organisation, one of the about polymorphic in humans, is of utmost clinical importance because of the loftier immunogenicity of its antigens, particularly antigens D and c. Antibodies against Rh antigens are responsible for transfusion accidents and for most of fetomaternal incompatibilities (Mollison 1979 ). X years ago, it was demonstrated that humans possess two RH genes that are closely linked on chromosome 1: RHD, which encodes the D polypeptide and is present or absent-minded depending on the RH haplotype (Colin et al. 1991 ), and RHCE, which displays 4 common alleles responsible for the expression of the two allelic serial of antigens C/c and Eastward/due east (Mouro et al. 1993 ). In a double dose, the complete deletion of RHD is responsible in Caucasians for the D-negative phenotype (Colin et al. 1991 ). In other populations (Africans, Japanese), D-negative individuals ofttimes possess in double-dose nonfunctional RHD genes which are wholly or partially deleted (Blunt, Daniels, and Carritt 1994 ; Hyland, Wolter, and Saul 1994; Daniels, Greenish, and Smart 1997 ; Okuda et al. 1997 ; Sun et al. 1998 ). RHCE and RHD are highly homologous and well-nigh probably derived by duplication from a common antecedent factor (Colin et al. 1991 ; Le Van Kim et al. 1992 ). This homology between RHD and RHCE probably promoted genetic exchanges between the two genes. This was demonstrated by the characterization at the genomic level of RHD genes which encode qualitative variants of the antigen D: well-nigh of these antigenic variants are encoded by low-frequency RHD alleles which display replacement of some exons by their RHCE counterparts. These replacements tin can be due to various mechanisms of intergenic exchange (double crossing over or factor conversion) (for a general review, encounter Huang 1997a ). Moreover, information technology was demonstrated that the four main alleles of the RHCE gene derived through intergenic exchanges and interallele recombinations from a few ancestor alleles (Carritt, Kemp, and Poulter 1997 ). Particularly, in humans, i gene exchange, consisting of the replacement of RHCE exon 2 by its RHD analogue, led to the appearance of RHCE alleles coding for the C antigen (Carritt, Kemp, and Poulter 1997 ).

Nonhuman primates express counterparts of the homo Rh antigens (Masouredis, Dupuy, and Elliot 1967 ; Moor-Jankowski and Wiener 1972 ). The utilize of monoclonal antibodies confirmed that chimpanzees and gorillas express polymorphic antigens, namely chimpanzee R^c and gorilla D^gor, which share epitopes with the human D antigen (Socha and Ruffié 1990 ; Blancher, Calvas, and Ruffié 1992 ). The expression of antigens R^c and D^gor was shown to depend on RH-like genes of chimpanzees and gorillas, respectively (Salvignol et al. 1993, 1994 ; Blancher and Socha 1997 ). Gibbons and orangutans too express D-like antigens, merely the small-scale number of animals studied did not allow the description of a polymorphism in these species (Blancher and Socha 1997 ). It has to be noted that if the expression of Rh-similar antigens seems to exist restricted to apes, the presence of Rh-like polypeptides at the surfaces of RBCs of Old Earth monkeys, New World monkeys, lemurs, and many other mammalians (cats, dogs, bovines, rats, mice) was evidenced by biochemical techniques (Saboori, Denker, and Agre 1989 ) or past immunoblotting (Mouro et al. 1994 ; Salvignol et al. 1995 ; Apoil and Blancher 1999 ). Despite their conservation throughout development, the function of Rh polypeptides remains elusive.

Southern blot studies demonstrated that but humans and African apes (chimpanzees and gorillas) possess more than than one cistron per haploid genome (Salvignol et al. 1993 ; Westhoff and Wylie 1994 ; Blancher and Socha 1997 ). Chimpanzees and gorillas possess at least 3 and two RH-like genes, respectively (Blancher and Socha 1997 ). Thus, it was deduced that the duplication event which led to the advent of the RHCE and RHD genes arose most probably in the common antecedent species of humans, chimpanzees, and gorillas.

The ii human RH genes differ in their coding sequences, just as well in their noncoding elements, including length polymorphisms of intron 3 (Matassi et al. 1997 ) and intron four (Arce et al. 1993 ). Intron iv of the RHCE gene differs from intron iv of the RHD cistron in the presence of a 654-bp fragment which encompasses an Alu-Sx element (Westhoff and Wylie 1996 ; Huang 1997b ; Okuda et al. 1997 ). Like humans, gorilla possesses introns 3 and 4 length polymorphisms which are counterparts of the RHD/RHCE intronic polymorphisms observed in humans (Westhoff and Wylie 1996 ; Apoil, Roubinet, and Blancher 1999 ). For case, some gorillas RH-like genes showroom RHCE-like introns 4 which harbor an Alu-Sx chemical element orthologous to the Alu in human RHCE intron 4 (Apoil, Roubinet, and Blancher 1999 ). Information technology was not possible from previous results to make up one's mind whether the Alu insertion in the RHCE gene arose later the duplication of a common ancestor factor or whether the RHD ancestor gene lost a 654-bp fragment. Results presented here are in good agreement with the deletion hypothesis.

Although chimpanzees and gorillas possess more than than i gene per haploid genome (Blancher, Calvas, and Ruffié 1992 ), comparative studies of chimpanzee and gorilla RH-like cDNAs did not bring a definitive demonstration that genetic exchanges have occurred between RH-like genes in these species (Salvignol et al. 1995 ; Apoil and Blancher 1999 ). With the aim of demonstrating such intergenic exchanges, nosotros decided to study noncoding parts of chimpanzee and gorilla RH-like genes.

Materials and Methods

Genomic DNA Samples

Homo genomic Deoxyribonucleic acid samples of 72 D-positive individuals (24 Caucasians, 24 African Blacks, 24 Amerindians) were provided by Jean Michel Dugoujon (Centre National de la Recherche Scientifique Unité propre de Recherche 8291, Toulouse, France). Chimpanzee (Pan troglodytes), gorilla (Gorilla gorilla), baboon (Papio papio), rhesus monkey (Macaca mulatta), and marmoset (Callithrix jacchus) blood samples were obtained from animals maintained at the Laboratory for Experimental Medicine and Surgery in Primates (LEMSIP, New York Medical Heart, New York University). Squirrel monkey (Saimiri sciureus) and brown lemur (Eulemur fulvus) blood samples were obtained from the Centre de Primatologie de Strasbourg, Nierderhausbergen, France. A claret sample from a Swiss mouse (Mus musculus) was fatigued later euthanasia.

Amplification and Sequencing of Introns iv ofRH-like Genes

Primers complementary to exons 4 or 5 of RH-like genes were deduced from the Rh cDNA nucleotide sequences previously characterized (Mouro et al. 1994 ; Salvignol et al. 1995 ; Apoil and Blancher 1999 ). The sequences of primers were Ex.4-dir1 (CGATACCCAGTTTGTCTGCCATGC), Ex.five-rev (TTGGGGTGAGCCAAGGATGAC(C/A)C), Ex.4-dir2 (AGCCTATTTTGGCTGACTG), Ex.4.cons-dir (GCCTATTTTGGGCTGACTGTGG), and Ex.5.cons-rev (GGCCAGAATATCCACAAGAAGAG).

The primer pairs Ex.4-dir1/Ex.5-rev, Ex.4-dir2/Ex.5-rev, and Ex.4.cons-dir/Ex.v.cons-rev were used for the amplification of RH-like introns four in humans and African apes, Old Globe monkeys and New World monkeys, and mice and lemurs, respectively. Thirty distension cycles were carried out using an enzyme mix of Taq and Pwo DNA polymerases (Aggrandize Loftier Fidelity, Boerhinger-Mannheim, Indianapolis, Ind.). Purified PCR products were sequenced by using the fluorescent dye terminator cycle sequencing method (PE Applied Biosystems, Foster City, Calif.). When required, amplified fragments were cloned into pCR two.1.TOPO plasmid vector (TOPO TA Cloning kit, Invitrogen, Leek, kingdom of the netherlands) and sequenced.

Length Polymorphism of Primate RHD-like Introns 3 and four

Primers Int.3-dir ((A/G)GGATTACAAGCAAGC-ATCACC) and Int.iii-rev (CACGCAC(C/T)TCACT-GATTCCTACTTC) were deduced from the intron 3 sequences of homo RH genes (Matassi et al. 1997 ). This pair of primers led to the amplification of 580-bp (RHCE intron iii) or 290-bp (RHD intron three) fragments with homo genomic DNA. This ready of primers was used to test for the presence of length polymorphism in the 3′ part of RH-like cistron introns 3 in chimpanzees and gorillas. The pair of primers Int.4.cons-dir (CTCCCTCCT-TTACCAA(C/G)TTC) and Int.4.cons-rev (AATCTGCATACCCCAGGC) allowed the distension of a short segment (140 bp) of RHD-like introns 4 nether the post-obit conditions: 25 cycles of PCR (denaturation for xv s, annealing for xx s at 55°C, and extension for 10 s) were carried out using 1.25 U of Taq DNA polymerase (QIAGEN, Hilden, Deutschland) in a reaction medium supplemented with 20% of Q-solution condiment (QIAGEN).

Association of Introns 3 and iv in Chimpanzee and Gorilla RH-like Genes

Primers RB46-dir (TGGCAAGAACCTGGACCTTGACTTT) (Matassi et al. 1997 ) and Ex.v-rev were used to amplify Deoxyribonucleic acid fragments encompassing intron 3 to the 5′ part of exon 5 from genomic Deoxyribonucleic acid samples of one chimpanzee and two gorillas. These three animals were selected because they possessed introns 3 of the RHCE and RHD-like types and introns 4 of RHD-like blazon ane and type ii. Amplicons recovered from agarose gel later on electrophoresis were partially sequenced. Sequences of segments surrounding the intron 3 RHD-specific deletion were characterized, as were regions encompassing exon 4, intron 4, and a part of exon 5 (see fig. one for details).

For one gorilla and one chimpanzee which possessed RHCE-similar intron 3 with RHCE-like intron 4, nosotros tested by PCR whether these 2 introns belonged to the aforementioned RH-similar gene. For this purpose, we used RB46-dir and RHCE.int.4-rev (CCACCCTTGTTCCTTCACTCCTGG). The latter primer is specific for the RHCE intron (encounter fig. 1 ). Amplicons recovered from agarose gel afterward electrophoresis were partially sequenced.

Phylogenetic Analysis

Intron iv nucleotide sequences were aligned using CLUSTAL W, version ane.7 (Thompson, Higgins, and Gibson 1994 ). Phylogenetic assay was carried out with the MEGA software parcel (Kumar, Tamura, and Nei 1993 ). Rates of substitutions (G values) were calculated according to Kimura'south (1980) ii-parameter method, and copse were reconstructed past the neighbor-joining method using the pairwise deletion selection. Ane g resampled versions of the original data set were generated past bootstrap, and the 1,000 respective trees were deduced past the neighbor-joining method.

Effect

Length of Intron 4 of Nonhuman Primate RH Genes

The lengths of the fragments amplified using DNA samples of diverse species were studied by agarose gel electrophoresis (fig. 2 ). From Deoxyribonucleic acid samples of 105 chimpanzees and 15 gorillas, we amplified a fragment with a length (0.five kb) like to that of the man RHD intron four. A 2nd blazon of fragment of a length similar to that of the RHCE intron 4 (1.25 kb) was amplified from the genomic DNAs of but 17 out of 105 chimpanzees and from merely 5 out of xv gorilla genomic DNAs. With genomic DNA samples of i orangutan, two gibbons, two baboons, three macaques, and two marmosets, PCR amplification of RH-similar introns four produced a single 1.25-kb fragment. The longest amplified products (0.iii kb longer than the human being RHCE product) were obtained from PCR amplification of squirrel monkey DNA (four individuals). The length of the amplified products from two brown lemurs (0.75 kb) was between those of amplified RHCE and RHD fragments. The shortest fragment (0.35 kb) was amplified from a mouse DNA sample.

Sequences of RH Introns 4

Nucleotide sequences of RH-like introns four were aligned to their human being counterparts (fig. three ). The exon segments 3′ and v′ of introns four were homologous to the corresponding cDNA sequences previously reported (Mouro et al. 1994 ; Salvignol et al. 1995 ; Apoil and Blancher 1999 ).

An Alu-Sx element was present in the RHCE-like introns 4 (1.25 kb) of chimpanzees, gorillas, rhesus monkeys, squirrel monkeys, and marmosets. All of these Alu elements vest to the Alu-Sx subfamily, as determined past analysis with CENSOR software (Jurka et al. 1996 ). Comparing the nucleotides of the intron 4 Alu-Sx elements with those of a consensus human being Alu-Sx sequence (Batzer et al. 1996 ) demonstrated the shut relationship existing between the intron 4 Alu-Sx sequences: 12 characteristic positions are shared by human and nonhuman primate intron 4 Alu-Sx sequences (fig. 3 ). Intron 4 in the squirrel monkey possesses the Alu-Sx element and an Alu-Sc inserted in a reverse orientation iii′ to the Alu-Sx chemical element (fig. 3 ). The Alu-Sc chemical element was identified by analysis with CENSOR software (Jurka et al. 1996 ).

Like human RHD intron 4, other primate intron iv sequences exhibited a deletion of a region encompassing the Alu element and 354 bp five′ of the Alu element. For that reason, these primate introns 4 were called RHD-like. In the chimpanzee and the gorilla, two types of RHD-similar intron 4 sequence were defined by the absence (RHD-like type 1) or the presence (RHD-like blazon 2) of a 12mer repeat 3′ of the deleted region (fig. 3 ).

The dark-brown lemur and mouse RH introns iv are also deprived of an Alu chemical element and are thus presented aligned with the homo RHCE intron 4 sequence with its Alu-Sx element deleted (fig. 4 ). This alignment confirms the insertion point of the Alu-Sx element in intron 4 of the RH gene antecedent mutual to Anthropoidea. The mouse Rh intron 4 is 356 bp long, and its sequence was too divergent from all primate sequences to exist inserted in figure iii , where merely variable positions are given.

Phylogenetic Study of RH-similar Introns 4

A phylogenetic written report was performed on the basis of the alignment of intron iv sequences. Only nucleotide positions included in segments of introns 4 present in all primate sequences were taken into account, thus excluding the Alu insert region. Lemur and mouse intron four sequences were excluded from the analysis, because we estimated that the deviation of intron sequences between lemurs, mice, and other primates was besides cracking to calculate a correct estimation of distances. A phylogenetic tree was reconstructed using the neighbour-joining method (fig. 5 ). The tree showed no deviations from the expected branching order, i.eastward., New World monkeys, Old World monkeys, and the "African" group, made up of humans, chimpanzees, and gorillas. All the same, genetic distances are shorter than expected betwixt sequences of humans, chimpanzees, and gorillas. These irregularities are weakly meaning considering bootstrap assay produced low levels of confidence for branchings within the "African" group of sequences.

Presence of RHD-like Introns 4 of Type 1 and Blazon 2 in Chimpanzees and Gorillas

The presence of RHD-like introns 4 of types 1 and two was investigated by PCR using a pair of primers (Int.4.cons-dir and Int.iv.cons-rev) which amplified a segment centered on the 12mer repeat nowadays in the blazon two RHD-like intron 4 (see Materials and Methods for more than details). Among 105 chimpanzees, 102 possessed the two types of RHD-like intron iv, and 3 possessed only the RHD-like type one intron. Among xv gorillas, vii possessed the two types of RHD-like intron iv, and viii possessed only type 1 RHD-like intron 4 (table i ).

The PCR amplification centered on the 12mer repeat demonstrated that all 72 human being DNA samples of various ethnic origins and of the D-positive type (24 Caucasians, 24 Africans, and 24 Amerindians) possessed counterparts of chimpanzee and gorilla RHD-like blazon ane introns 4 and lacked counterparts of RHD-like type 2 introns 4.

Polymorphism of Intron 3 in Chimpanzees and Gorillas

As human RHD and RHCE genes differ in the length of intron 3, nosotros searched for a similar polymorphism in chimpanzees and gorillas wuth a PCR assay (see Materials and Methods). From all chimpanzee Deoxyribonucleic acid samples (N = 105), products of lengths equivalent to those of homo RHCE and RHD, respectively, were obtained. RHD-similar and RHCE-like intron 3 fragments were obtained with 7 of 15 gorilla Deoxyribonucleic acid samples. With the remaining viii gorilla samples, merely RHCE-like fragments were obtained (table one ). Partial sequences of the chimpanzee and gorilla PCR products confirmed that they were amplified from RH-like genes (data not shown).

Types of Associations Between Introns three and Introns iv and Estimated Frequencies of RH Haplotypes in Chimpanzees

In order to investigate the diverse combinations of introns iii and 4 in chimpanzee and gorilla RH-like genes, amplifications of long genomic fragments were performed. Fragments were separated on the basis of their lengths and were checked by sequencing for the presence of RHD-similar specific deletions in introns 3 and 4 and for the presence of the RHD-like type 2 add-on in intron 4 (encounter Materials and Methods and fig. one ). From one chimpanzee and one gorilla, DNA fragments of two kb containing RHCE-similar introns iii and 4 were amplified by means of a primer in intron three (RB46-dir) and a primer specific to the RHCE intron 4 (RHCE.Int.4-rev). The corresponding RH-like genes were named "Chimp CE/CE" and "Gor CE/CE" (fig. vi ). Partial sequencing of chimpanzee and gorilla amplicons confirmed the presence of RHCE-specific elements in intron 3 and intron 4.

Genomic DNAs of four animals (2 chimpanzees and 2 gorillas) which possessed both types of intron 3 and RHD-like intron 4 of types 1 and 2 were amplified from intron iii to exon v (encounter fig. 1 ). Two types of fragments were obtained of respective lengths 1.95 and 2.25 kb. Partial sequencing of the chimpanzee and gorilla 1.95-kb fragments demonstrated that they contained an RHD-like intron three and an RHD-like intron 4 of type one ("Gor D/D1," "Chimp D/D1"; fig. 6 ). Fractional sequencing of the 2.25-kb fragment demonstrated that it contained RHCE-like intron 3 and an RHD-similar intron 4 of type 2 ("Gor CE/D2," "Chimp CE/D2": fig. half-dozen ).

All attempts to amplify genomic fragments associating RHCE-like introns 3 with RHD-like type 1 introns 4 in chimpanzees and gorillas failed. Therefore, the existence of a gorilla RH-like gene associating RHCE-like introns iii with blazon 1 RHD-like introns 4 is questionable. Information technology is possible, therefore, that these ii introns practise non belong to the same factor (the h1 haplotypes of gorillas and chimpanzees in fig. half dozen ).

Every bit 105 randomly selected chimpanzees (table ane ) were studied for the presence of introns 3 and four, ane tin can propose the beingness of at least iii RH haplotypes and estimate their frequencies. The presence of iii RH-like genes per chimpanzee haploid genome was previously demonstrated (Blancher, Calvas, and Ruffié 1992 ); therefore, only three-gene haplotypes are proposed in this paragraph. Iii chimpanzees possessed a phenotype suggesting that they were homozygotes for haplotype h1 (frequency = p) which associates RH-like genes [D/D1–CE/?–?/?], divers by intron 3/iv combinations (question marks indicate the impossibility of assessing the type of intron). According to the Hardy-Weinberg binomial formula, the frequency of haplotype 1 is p ^two. In the same mode, 85 animals are expected to be either homozygotes of haplotype h2 (frequency = q) [D/D1–CE/D2–?/?] or heterozygotes of haplotypes h1 and h2, and the calculated frequency is q ² + 2pq. Finally, 17 chimpanzees are considered either homozygotes of haplotype h3 (frequency = r) [D/D1–?/D2–CE/CE] or heterozygotes of haplotypes h2 and h3, with a frequency of r ² + 2pr + 2qr. The approximate estimations for p, q, and r are 0.17, 0.75, and 0.08, respectively, and are reported in figure 6 . Obviously, many other haplotype combinations can be proposed, and only the consummate sequencing of the chimpanzee RH loci of numerous animals could pb to a definite description of chimpanzee haplotypes. In addition, the respective positions of RH-like genes in chimpanzee and gorilla genomes, equally shown in effigy 6 , are arbitrary.

The 15 gorillas studied here displayed four types of combination between the iii types of intron 4 and the two types of intron 3 (table one ). One of these combinations consisted in the presence of RHCE-similar intron 3 and RHD-like intron 4 of blazon one (half dozen gorilla samples). From the existence of this combination, ane can infer that in some gorilla genes, RHCE-like intron 3 is associated with type 1 RHD-like intron 4. Notwithstanding, the existence of such a gorilla RH-like factor is questionable, because, equally mentioned above, all attempts to amplify genomic fragments associating RHCE-similar introns three with type 1 RHD-like introns iv in gorillas failed.

Discussion

We demonstrate hither that an Alu-Sx element is inserted in orthologous positions in RH-like gene introns 4 of humans, not bad apes, New World monkeys, and Onetime World monkeys. These results led us to conclude that an Alu-Sx element was most probably inserted into the RH gene of the common ancestor of Old World monkeys and New World monkeys after the separation of this ancestor from the lemur lineage. In humans, this Alu-Sx element is present just in RHCE intron iv. The human RHD gene differs from the RHCE gene by the absence of this Alu-Sx element and of 354 bp 5′ of the Alu. This 354-bp DNA segment is homologous to a region of the lemur RH-like intron four sequence. This homology led us to propose that the insertion of the Alu-Sx in the RH ancestor gene was 3′ of this region (see fig. 4 ). The v′ and 3′ Alu flanking sequences displayed great variability in length between species (lower part of fig. three ). In marmosets and squirrel monkeys, the 5′ Alu-Sx flanking regions contain repeats of x (marmoset) to 28 (squirrel monkey) thymidines which are replaced in humans and apes past a 12mer poly-A sequence. The respective zone in the rhesus monkey consists of a mixture of A, T, and G. Moreover, the squirrel monkey intron iv displays a 2nd Alu chemical element which belongs to the Alu-Sc subfamily, inserted in reverse orientation in the 5′ poly-T flanking sequence of the Alu-Sx. The insertion of the Alu-Sc occurred later on the insertion of the Alu-Sx element because the expansion of the Alu-Sx subfamily in primate genomes preceded that of the Alu-Sc (Kapitonov and Jurka 1996 ).

Some chimpanzee and gorilla RH-like genes were shown to possess RHCE-like introns 4 encompassing an Alu-Sx element in a position orthologous to that observed in the human RHCE gene. However, whereas all humans, apart from exceptional variants ( Huang 1997a ), possess the RHCE cistron, and thus introns 4 of the RHCE blazon, only 16% of the chimpanzees (17/105) and 33% of the gorillas (5/fifteen) studied here possessed an RHCE-like intron 4.

Like humans, chimpanzees and gorillas also possess RHD blazon introns iv. Both homo RHD and ape RHD-similar introns four are deprived of a 654-bp segment which is present in RHCE and RHCE-like introns iv. In addition, some chimpanzee and gorilla RHD-like introns four showroom an additional 12mer repetitive DNA segment 3′ of the deleted region. Introns without the repeat were referred to as blazon 1 RHD-similar, while RHD-like introns 4 with the 12mer segment were designated type ii RHD-like. The chimpanzee blazon two RHD-like intron 4 is homologous to the chimpanzee sequence previously reported by Westhoff and Wylie (1996) .

In humans, the absenteeism of RHD is frequent (15% of Caucasians are D-negative and do not possess RHD introns four in their genomes). In African apes, absence of RHD-like introns 4, if possible, must be infrequent, as all chimpanzees and all gorillas tested and so far have possessed blazon 2 and/or type 1 RHD-like introns 4. Withal, it has to be noted that in the series reported past Westhoff and Wylie (1996) , one gorilla out of v and no chimpanzees out of vii were negative for the distension of RHD-like introns iv.

The corking homology between man RHD intron 4 and RHD-similar (type one and type two) introns 4 of gorillas and chimpanzees suggests a common ancestry of the corresponding genes. 1 can hypothesize that the common ancestor gene of RHD and RHD-like genes already displayed the deletion encompassing the Alu-Sx, together with 354 bp 5′ of the Alu. Although excision of Alu elements is a rare consequence, examples accept previously been described by others (Meagher, Jorgensen, and Deeb 1996 ; Satta, Mayer, and Klein 1996 ). It is noteworthy that simply chimpanzees and gorillas possess type two RHD-similar intron iv, which differs from type 1 RHD-like intron four by the presence of a 12mer repeat (fig. 3 ). Indeed, using a pair of primers adapted to the detection of RHD-like intron 4 polymorphisms (presence or absence of the 12mer repeat), we demonstrated past PCR the absence of a counterpart of the apes' type 2 RHD intron 4 in 72 human genomic samples. Taken together, the results advise that the common ancestor of chimpanzees and gorillas, which is supposed to as well be the antecedent of humans, possessed the blazon two RHD intron four. This led u.s.a. to conclude that humans, unlike chimpanzees and gorillas, about probably lost the gene(s) harboring type 2 RHD intron 4. To verify this hypothesis, it remains to place the relicts of this deletion in the human genome and to report a larger number of individuals, considering the RHD blazon ii intron could exist present in humans at very low frequency and maybe only in some peculiar populations.

Equally reported elsewhere, gorillas express a D-similar polymorphic antigen called D^gor (Roubinet et al. 1993 ). The expression of the D^gor antigen is associated with restriction length polymorphisms revealed past probing Southern blots with an exon-4-specific probe and with a PCR length polymorphism of the RHD-similar intron 3 (Apoil, Roubinet, and Blancher 1999 ). In the present study, nosotros demonstrate that the expression of D^gor is also associated with the presence in the gorilla genome of the type two RHD-like intron 4 and, therefore, with the presence of a haplotype associating the "Gor D/D1" and "Gor CE/D2" genes (fig. 6 and table ane ). Still, it is not possible to accredit 1 of these two genes to the expression of D^gor. Gorilla RH-like genes associated with type 1 RHD intron 4 are also functional because D^gor-negative animals are agglutinated by some anti-D reagents and express Rh-like proteins at the surfaces of their carmine blood cells (RBCs) (Blancher and Socha 1997 ; Apoil, Roubinet, and Blancher 1999 ). Although it is not possible to assess whether or not the gorilla Gor CE/CE gene is functional, partial exon sequences of this factor established its homology with the human RhcE cDNA (Apoil, Roubinet, and Blancher 1999 ). In chimpanzees, the absence of association between the intron 3 and 4 PCR patterns and the R-C-East-F types or the restriction patterns (data not shown) did not allow us to specify the functionality of the RH-like genes described here. Still, all of the animals studied here were agglutinated by some anti-D monoclonal reagents and express Rh-like proteins at the surfaces of their RBCs.

Chimpanzees and gorillas displayed a keen variety of combinations between the various types of RH-like introns 3 and 4. This variety is indirect evidence that intergenic exchanges betwixt RH-similar genes in these two species were non infrequent (Blancher and Socha 1997 ). However, if these intergenic exchanges were frequent, they would have homogenized RH sequences in each species. This would result in a clustering of sequences by species. In fact, this is non observed in the phylogenetic tree presented in figure 5 .

In conclusion, the numerical chromosomal polymorphism of RH genes (the human being locus displays either 1 or 2 genes, the chimpanzee possesses three, and the gorilla possesses two) suggests that unequal crossing over nearly probably arose later on the original duplication of the RH antecedent gene. Intergenic exchanges by various mechanisms (double crossing over, homologous recombination, or gene conversion) betwixt RH genes have occurred in humans and the two other species possessing more than than i RH gene (i.east., chimpanzees and gorillas). Even so, despite these intergenic exchanges, the coding regions of human being RHD and RHCE genes (417 codons) differ by 41 nucleotide substitutions, with 35 being nonsynonymous. This suggests that the differentiation of the two man RH genes (RHD and RHCE) was maintained because it represented a selective advantage.

Naruya Saitou, Reviewing Editor

Keywords: RH genes, development, intronic polymorphism, Alu elements.

Address for correspondence and reprints: Antoine Blancher, Laboratoire d'Immunologie, Center Hospitalier Universitaire Purpan, 31059 Toulouse cedex, France. E-mail: blancher@mail.easynet.fr.

Fig. 1.—Relative positions of primers used for PCR distension. The black rectangles correspond to regions which are nowadays in introns of the RHCE blazon and absent from introns of the RHD type. The primers used for the report of intron length polymorphims are indicated (names of primers in italics). A pair of primers (RB.46-dir and Exon5-rev) was used to amplify long genomic fragments.

Fig. 2.—Length polymorphism of intron 4 of RH genes. Intron 4 was amplified from genomic Deoxyribonucleic acid of primates and mice with species-specific primers. The bands corresponding to PCR products amplified from the RHCE or the RHD genes in humans are indicated on the left. OWM = Old Earth monkeys; NWM = New World monkeys. Lane ane: homo, D-positive; lane ii: human being, D-negative; lane 3: chimpanzee "Ch.534"; lane four: chimpanzee "Ch.500"; lane 5: gorilla "Alexis"; lane six: gorilla "Dian"; lane 7: orangutan "OO.941"; lane 8: gibbon "Tiga"; lane 9: rhesus monkey "PMC"; lane 10: crab-eating macaque "J189"; lane xi: baboon "B393"; lane 12: squirrel monkey "S55"; lane 13: marmoset "MJ40017"; lane 14: brownish lemur "Sonic"; lane xv: Swiss mouse.

Fig. 3.—Comparison of human RH and primate RH-like intron 4 sequences. Sequences are presented in reference to the RHCE gene intron 4, with a dot for nucleotide identity and a dash for nucleotide deletion. Nucleotide positions are numbered according to the homo RHCE intron 4 (GenBank accession number AF050636; Apoil, Roubinet, and Blancher 1999 ). The upper part of the figure presents the alignment for the v′ and iii′ segments of the introns, excluding the Alu insert. The lower function of the figure presents the variable positions of Alu-Sx elements found in RH intron 4 of primates by reference to a consensus human Alu-Sx sequence (Batzer et al. 1996 ), together with the polymorphic 5′ and three′ flanking sequences. An Alu-Sc element is inserted into the 5′ flanking region of the squirrel monkey intron. The possible transcription orientations of Alu elements are indicated past arrows. The 12mer duplication (GAGCAGGTTCAG) which is present in the RHD type 2 introns 4 of chimpanzees and gorillas is indicated with a black triangle. Sequences of gorilla RHCE-like (AF049913) and RHD-like type ane (AF071197) introns 4 were previously reported (Apoil, Roubinet, and Blancher 1999 ).

Fig. 4.—Alignment of lemur and mouse RH-like introns 4 with the human RHCE intron 4 sequence, which is taken as a reference; nucleotide identities are indicated with dots, and nucleotide deletions are indicated withdashes. The sequences of lemur and mouse RH-like introns four are aligned with the human being RHCE sequence (AF050636) afterward removal of the Alu-Sx element. The signal of insertion of the Alu-Sx element in the RHCE sequence is indicated. The 354-bp segment which is deleted, together with the Alu in RHD intron iv, is indicated in bold type.

Fig. v.—Phylogenetic tree computed from the sequences of RH cistron introns four. Distances were calculated using Kimura'southward (1980) two-parameter method on the basis of the nucleotide positions shown in effigy 2 excluding the Alu insert. One yard resampled versions of the original information sets were generated by bootstrapping, and the respective trees were deduced by the neighbor-joining method with MEGA software (Kumar, Tamura, and Nei 1993 ). The frequencies of branchings equivalent to those of the tree presented in the figure are indicated on the branches of the tree. *Bootstrap values <50%.

Fig. 6.—RH-like genes and proposed haplotypes in humans and African apes. 1, Chimpanzee and gorilla RH-similar genes for which the segment encompassing intron iii to exon 5 was characterized by PCR, cloning, and sequencing are presented. RHCE-like and RHD-similar introns iii (left part of genes boxes) and RHCE-like and RHD-like type ane and blazon ii introns 4 (correct part of gene boxes) are shown to emphasize the intron iii and 4 combinations. 2, But the ii common human RH haplotypes are presented. A question marking is present when the type of intron iii or 4 could non be assessed by PCR and sequencing. Three-cistron haplotypes h1, h2, and h3 are proposed for chimpanzees on the basis of the intron iii and 4 combinations which were observed in 105 animals (see text), and their calculated frequencies are shown. Gorilla two-cistron haplotypes h1, h2, and h3 are predicted from intron combinations observed in six, four, and two animals, respectively (table 1 ). The respective positions of RHD and RHCE on human chromosome i are the same as those proposed by Carrit, Kemp, and Poulter (1997); the respective positions of gorilla and chimpanzee RH-like genes are arbitrary.

table ane Length Polymorphisms in RH-like Introns 3 and four of African Apes

This work was realized with funds from MESR (Contract Jeune Équipe 1966) and from Agence Française du Sang (Contract 65001731231). We are indebted to Stéphanie Despiau for her very efficient technical assist in sequencing. All experiments described in this article were performed in agreement with French laws and regulations currently in forcefulness. We thank Doctor Naruya Saitou for helpful word and critical review. The RH and RH-like gene intron 4 nucleotide sequences reported in this paper accept been submitted to the EMBL/GenBank nucleotide sequence databases and accept been assigned the following accession numbers: chimpanzee RHCE-similar, RHD-similar type 1, and RHD-similar type 2—AF045542, AF071199, and AF071198, respectively; gorilla RHD-like type 2—AF071200; rhesus monkey—AF045541; squirrel monkey—AF081795; marmoset—AF045540; chocolate-brown lemur—AF045544; mouse—AF045543.

References

Apoil, P.-A., and A. Blancher.

1999

. Sequence and evolution of mammalian RH gene transcripts and proteins. Immunogenetics 49:15–25.

Apoil, P.-A., F. Roubinet, and A. Blancher.

1999

. Gorilla Rh-similar genes and antigens. Immunogenetics 49:125–133.

Arce, M. A., East. Scott-Thompson, S. Wagner, K. E. Coyne, B. A. Ferdman, and D. M. Lublin.

1993

. Molecular cloning of RhD cDNA derived from a gene present in RhD positive, only not RhD-negative individuals. Blood 82:651–655.

Batzer, 1000. A., P. L. Deininger, U. Hellmann-Blumberg, J. Jurka, D. Labuda, C. K. Rubin, C. W. Schmid, E. Zietkiewicz, and E. Zuckerkandl.

1996

. Standardized nomenclature for Alu repeats.

J. Mol. Evol.

–half-dozen.

Blancher, A., P. Calvas, and J. Ruffié.

1992

. Etude des équivalents des antigènes Rhésus chez les primates not hominiens.

C. R. Soc. Biol.

186

682

–695.

Blancher, A., and W. W. Socha.

1997

. The Rhesus system. Pp. 147–218 in A. Blancher, J. Klein, and W. Westward. Socha, eds. Molecular biology and evolution of blood group and MHC antigens in primates. Springer Verlag, Heidelberg, Federal republic of germany.

Blunt, T., G. Daniels, and B. Carritt.

1994

. Serotype switching in a partially deleted RHD gene.

Vocalisation Sang.

397

–401.

Carritt, B., T. J. Kemp, and M. Poulter.

1997

. Evolution of the human RH (rhesus) blood group genes: a l twelvemonth old prediction (partially) fulfilled.

Hum. Mol. Genet.

843

–850.

Colin, Y., B. Chérif-Zahar, C. Le Van Kim, V. Raynal, V. Van Huffel, and J. P. Cartron.

1991

. Genetic basis of the RhD-positive and RhD-negative blood grouping polymorphism equally determined by Southern assay. Blood 78:2747–2752.

Daniels, G., C. Green, and E. Smart.

1997

. Differences between RhD-negative Africans and RhD-negative Europeans. Lancet 350:862–863.

Huang, C. H. 1997a. Molecular insights into the Rh protein family and associated antigens. Curr. Opin. Hematol. iv:94–103.

———. 1997b. Man D^VI category erythrocytes: correlation of the phenotype with a novel hybrid RHD-CE-D gene but non an internally deleted RHD gene. Claret 89:1834–1839.

Hyland, C. A., 50. C. Wolter, and A. Saul.

1994

. Iii unrelated RhD cistron polymorphisms identified among claret donors with Rhesus Ccee (r′r′) phenotypes. Claret 84:321–324.

Jurka, J., P. Klonowski, V. Dagman, and P. Pelton.

1996

. Conscience—a programme for identification and elimination of repetitive elements from DNA sequences.

Comput. Chem.

119

–122.

Kapitonov, V., and J. Jurka.

1996

. The age of Alu subfamilies J.

Mol. Evol.

–65.

Kimura, One thousand.

1980

. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences.

J. Mol. Evol.

111

–120.

Kumar, S., Grand. Tamura, and 1000. Nei.

1993

. MEGA: molecular evolutionary genetics analysis. Version 1.01. Pennsylvania Country University, Academy Park.

Le Van Kim, C., I. Mouro, B. Chérif-Zahar, V. Raynal, C. Cherrier, J. P. Cartron, and Y. Colin.

1992

. Molecular cloning and main construction of the human blood group RhD polypeptide. Proc. Natl. Acad. Sci. USA 89:10925–10929.

Masouredis, S. P., Thou. E. Dupuy, and 1000. Elliot.

1967

. Distribution of Rho (D) antigen in the reds cells of not-human primates.

J. Immunol.

–xv.

Matassi, G., B. Chérif-Zahar, I. Mouro, and J. P. Cartron.

1997

. Characterization of the recombination hot spot involved in the genomic rearrangement leading to the hybrid D-CE-D gene in the D^Half-dozen phenotype.

Am. J. Hum. Genet.

808

–817.

Meagher, 1000. J., A. L. Jorgensen, and S. S. Deeb.

1996

. Sequence and evolutionary history of the length polymorphism in intron 1 of the human red photopigment gene.

J. Mol. Evol.

622

–630.

Mollison, P. Fifty.

1979

. Blood transfusion in clinical medicine. sixth edition. Blackwell Scientific Publications, London.

Moor-Jankowski, J., and A. Southward. Wiener.

1972

. Reddish cell antigens of primates. Pp. 270–317 in T. W. Fiennes, ed. Pathology of simian primates. Karger Basel, London.

Mouro, I., Y. Colin, B. Chérif-Zahar, J. P. Cartron, and C. Le Van Kim.

1993

. Molecular genetic footing of the human being Rhesus blood group system.

Nat. Genet.

–65.

Mouro, I., C. Le Van Kim, B. Chérif-Zahar, I. Salvignol, A. Blancher, J. P. Cartron, and Y. Colin.

1994

. Molecular label of the Rh-like locus and factor transcripts from the rhesus monkey (Macaca mulatta).

J. Mol. Evol.

169

–176.

Okuda, H., M. Kawano, S. Iwamoto, Yard. Tanaka, T. Seno, Y. Okubo, and E. Kajii.

1997

. The RHD gene is highly detectable in RhD-negative donors.

J. Clin. Invest.

100

373

–379.

Roubinet, F., A. Blancher, W. W. Socha, and J. Ruffié.

1993

. Quantitative written report of chimpanzee and gorilla counterparts of the human D antigen.

J. Med. Primatol.

–35.

Saboori, A. K., B. M. Denker, and P. Agre.

1989

. Isolation of proteins related to the Rh polypeptides from nonhuman erythrocytes.

J. Clin. Invest.

187

–191.

Salvignol, I., A. Blancher, P. Calvas, Due west. Westward. Socha, Y. Colin, J. P. Cartron, and J. Ruffié.

1993

. Relationship between chimpanzee RH-like genes and the R-C-E-F claret group system.

J. Med. Primatol.

–28.

Salvignol, I., A. Blancher, P. Calvas, J. Clayton, W. West. Socha, Y. Colin, and J. Ruffié.

1994

. Molecular genetics of chimpanzee Rh-related genes: their relationship with the R-C-E-F claret group arrangement, the chimpanzee counterpart of the man rhesus organisation.

Biochem. Genet.

201

–220.

Salvignol, I., P. Calvas, W. W. Socha, Y. Colin, C. Le Van Kim, P. Bailly, J. Ruffié, J. P. Cartron, and A. Blancher.

1995

. Structural analysis of the RH-like blood group gene products in nonhuman primates. Immunogenetics 41:271–281.

Satta, Y., West. E. Mayer, and J. Klein.

1996

. HLA-DRB intron 1 sequences: implications for the evolution of HLA-DRB genes and haplotypes.

Hum. Immunol.

ane

–12.

Socha, W. W., and J. Ruffié.

1990

. Monoclonal antibodies directed against human Rh antigens in examination with the cherry cells of non-human primates.

Rev. Fr. Transfus. Hemobiol.

–48.

Sunday, C.-F., C.-S. Chou, N.-C. Lai, and W.-T. Lang.

1998

. RHD factor polymorphisms among RhD-negative Chinese in Taiwan.

Vox Sang.

–57.

Thompson, J. D., D. J. Higgins, and T. J. Gibson.

1994

. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choices.

Nucleic Acids Res.

4673

–4680.

Westhoff, C. Yard., and D. E. Wylie.

1994

. Investigation of the human Rh blood grouping organisation in nonhuman primates and other species with serologic and Southern blot analysis.

J. Mol. Evol.

–92.

———.

1996

. Investigation of the RH locus in gorillas and chimpanzees.

J. Mol. Evol.

658

–668.

Source: https://academic.oup.com/mbe/article/17/1/127/975586

Posted by: kimafor1996.blogspot.com

Do Any Animals Have Rh Negative Blood

Abstract

Introduction

Materials and Methods

Genomic DNA Samples

Amplification and Sequencing of Introns iv ofRH-like Genes

Length Polymorphism of Primate RHD-like Introns 3 and four

Association of Introns 3 and iv in Chimpanzee and Gorilla RH-like Genes

Phylogenetic Analysis

Effect

Length of Intron 4 of Nonhuman Primate RH Genes

Sequences of RH Introns 4

Phylogenetic Study of RH-similar Introns 4

Presence of RHD-like Introns 4 of Type 1 and Blazon 2 in Chimpanzees and Gorillas

Polymorphism of Intron 3 in Chimpanzees and Gorillas

Types of Associations Between Introns three and Introns iv and Estimated Frequencies of RH Haplotypes in Chimpanzees

Discussion

References

0 Response to "Do Any Animals Have Rh Negative Blood"

Post a Comment

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel